The following mature miRNA have the same seed sequence: GGGCCCC
| ID | hsa-miR-296-5p |
| Accession | MIMAT0000690 |
| Sequence | 14 - AGGGCCCCCCCUCAAUCCUGU - 34 |
| Seed Sequence | GGGCCCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- neoplasia
- lupus nephritis
- infantile hemangioma formation
- pilocarpine-induced status epilepticus
- non-small cell lung carcinoma
- non-small cell lung cancer
- vulvar melanoma
- vulva cancer
- kainic acid-induced epileptic seizure
role in cell
- expression in
- number
- proliferation
- migration
- differentiation
- translation in
- epithelial-mesenchymal transition in