The following mature miRNA have the same seed sequence: CUGGACU
| ID | hsa-miR-378a-3p |
| Accession | MIMAT0000732 |
| Sequence | 43 - ACUGGACUUGGAGUCAGAAGGC - 64 |
| Seed Sequence | CUGGACU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- neoplasia
- organismal death
- pilocarpine-induced status epilepticus
- liver cancer
- epithelial cancer
- breast cancer
- hypopharyngeal squamous cell carcinoma
- squamous cell cancer of the hypopharynx
- psoriasis
role in cell
- expression in
- phosphorylation in
- proliferation
- invasion by
- migration
- survival
- apoptosis
- number
- colony formation by
- growth in