The following mature miRNA have the same seed sequence: AAGUUGU
| ID | hsa-miR-382-5p |
| Accession | MIMAT0000737 |
| Sequence | 11 - GAAGUUGUUCGUGGUGGAUUCG - 32 |
| Seed Sequence | AAGUUGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- schizophrenia
- myelin oligodendrocyte glycoprotein induced experimental autoimmune encephalomyelitis
- intrahepatic cholestasis of pregnancy
- gallbladder cancer
role in cell
- cell viability
- expression in
- apoptosis