The following mature miRNA have the same seed sequence: CUCACAC
| ID | hsa-miR-342-3p |
| Accession | MIMAT0000753 |
| Sequence | 61 - UCUCACACAGAAAUCGCACCCGU - 83 |
| Seed Sequence | CUCACAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- severe asthma
- colorectal adenocarcinoma
- colorectal carcinomagenesis
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- psoriasis
- glioma
- glioma formation
- infantile hemangioma formation
role in cell
- expression in
- proliferation
- phosphorylation in
- number
- differentiation
- invasion by
- basal oxygen consumption rate