The following mature miRNA have the same seed sequence: GAGGUAG
| ID | hsa-let-7a-5p |
| Accession | MIMAT0000062 |
| Sequence | 6 - UGAGGUAGUAGGUUGUAUAGUU - 27 |
| Seed Sequence | GAGGUAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- liver cancer
- neoplasia
- adenoma formation
- tumorigenesis
- colorectal cancer
- experimental autoimmune encephalomyelitis
- dilated cardiomyopathy
- lung cancer
- heart disease
role in cell
- expression in
- apoptosis
- phosphorylation in
- proliferation
- growth
- G1/S phase transition
- migration
- differentiation
- production in
- formation