The following mature miRNA have the same seed sequence: AUUGCAC
| ID | hsa-miR-25-3p |
| Accession | MIMAT0000081 |
| Sequence | 52 - CAUUGCACUUGUCUCGGUCUGA - 73 |
| Seed Sequence | AUUGCAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-small cell lung cancer
- primary central nervous system lymphoma
- neoplasia
- metastasis
- gastric cancer
- experimental autoimmune encephalomyelitis
- lung cancer
- Alzheimer disease
- liver metastasis
- vaginal melanoma
role in cell
- production in
- expression in
- activation in
- cell death
- phosphorylation in
- upregulation in
- apoptosis
- damage in
- binding in
- proliferation