The following mature miRNA have the same seed sequence: AGCACCA
| ID | hsa-miR-29a-3p |
| Accession | MIMAT0000086 |
| Sequence | 42 - UAGCACCAUCUGAAAUCGGUUA - 63 |
| Seed Sequence | AGCACCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- experimental autoimmune encephalomyelitis
- pancreatic ductal adenocarcinoma
- Alzheimer disease
- late-onset preeclampsia
- melanoma cancer
- non-insulin-dependent diabetes mellitus
- rheumatoid arthritis
- obesity
- schizophrenia
- chronic lymphocytic leukemia
role in cell
- expression in
- growth
- cell death
- phosphorylation in
- upregulation in
- apoptosis
- proliferation
- induction in
- self-renewal
- migration