The following mature miRNA have the same seed sequence: AUGGCAC
| ID | hsa-miR-183-5p |
| Accession | MIMAT0000261 |
| Sequence | 27 - UAUGGCACUGGUAGAAUUCACU - 48 |
| Seed Sequence | AUGGCAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- epithelial cancer
- breast cancer
- non-insulin-dependent diabetes mellitus
- hepatocellular carcinoma
- endometrioid endometrial adenocarcinoma
- endometrioid endometrial cancer
- gastric cancer
- postmenopausal osteoporosis
- lung squamous cell carcinoma
role in cell
- expression in
- apoptosis
- proliferation
- glycolysis in