The following mature miRNA have the same seed sequence: UGUGCUU
| ID | hsa-miR-218-5p |
| Accession | MIMAT0000275 |
| Sequence | 25 - UUGUGCUUGAUCUAACCAUGU - 45 |
| Seed Sequence | UGUGCUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- atherosclerosis
- glioblastoma cancer
- mammary neoplasm
- breast cancer
- hypopharyngeal squamous cell carcinoma
- squamous cell cancer of the hypopharynx
- primary melanoma
- melanoma cancer
- primary cancer
role in cell
- growth
- expression in
- apoptosis
- accumulation in
- proliferation
- invasion by
- migration
- number
- Gap 0-Gap 1 phase
- cisplatin sensitivity