The following mature miRNA have the same seed sequence: UCCAGUU
| ID | hsa-miR-145-5p |
| Accession | MIMAT0000437 |
| Sequence | 16 - GUCCAGUUUUCCCAGGAAUCCCU - 38 |
| Seed Sequence | UCCAGUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- neoplasia
- epithelial cancer
- colorectal cancer
- vulvar melanoma
- vulva cancer
- metastasis
- esophageal cancer
- colorectal adenocarcinoma
- colorectal carcinomagenesis
role in cell
- activation in
- apoptosis
- expression in
- proliferation
- growth
- cell viability
- cell death
- formation
- formation in
- number