The following mature miRNA have the same seed sequence: AAAGAAU
| ID | hsa-miR-186-5p |
| Accession | MIMAT0000456 |
| Sequence | 15 - CAAAGAAUUCUCCUUUUGGGCU - 36 |
| Seed Sequence | AAAGAAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- breast cancer
- liver cancer
- focal segmental glomerulosclerosis
- HIV-associated lipodystrophy syndrome
- sporadic amyotrophic lateral sclerosis
- nasal type extranodal NK-/T-cell lymphoma
- mature T-cell neoplasia
- T-cell non-Hodgkin disease
- natural killer cell neoplasia
role in cell
- expression in
- morphology
- apoptosis
- proliferation
- migration
- cell viability
- quantity
- invasion by
- cytotoxicity
- G0/G1 phase transition