The following mature miRNA have the same seed sequence: UCAUGAU
| ID | hsa-miR-433-3p |
| Accession | MIMAT0001627 |
| Sequence | 64 - AUCAUGAUGGGCUCCUCGGUGU - 85 |
| Seed Sequence | UCAUGAU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- experimental autoimmune encephalomyelitis
- lupus nephritis
- deep vein thrombosis
- glioma
- glioma formation
role in cell
- migration
- apoptosis
- expression in
- proliferation
- glycolysis in
- invasion by
- M2 polarization