The following mature miRNA have the same seed sequence: GGGUCUU
| ID | hsa-miR-193a-5p |
| Accession | MIMAT0004614 |
| Sequence | 21 - UGGGUCUUUGCGGGCGAGAUGA - 42 |
| Seed Sequence | GGGUCUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- metastasis
- non-small cell lung cancer
- colorectal carcinomagenesis
- colorectal adenocarcinoma
- soft tissue sarcoma cancer
- cervical cancer
- liposarcoma
role in cell
- expression in
- apoptosis
- phosphorylation in
- cell viability
- M2 polarization
- migration
- activation in
- invasion by
- inhibition in
- epithelial-mesenchymal transition