Mirna Stemloop Summary
| id | hsa-mir-34a |
| Accession | MI0000268 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Dostie et al. independently cloned this sequence in human but misnamed the sequence miR-172 (the sequence is unrelated to MIR172 from Arabidopsis) [2]. The sequence maps to human chromosome 1. Human miR-34a was previously named miR-34 here and in [1], but is renamed to clarify homology with the alternatively named mouse sequence (MIR:MI0000584). The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [3]. |
| Description | Homo sapiens miR-34a stem-loop |
| Gene Family | MIPF0000039;mir-34 |
| Genome Context | chr1: 9151668-9151777 [-] |
| miRna Matures Links | |
| Sequence | GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC |