The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-34a |
| Accession | MI0000268 |
| Genome Context | chr1: 9151668-9151777 [-] |
| Associated Mature miRNA | |
| Sequence | GGCCAGCUGUGAGUGUUUCUUUGGCAGUGUCUUAGCUGGUUGUUGUGAGCAAUAGUAAGGAAGCAAUCAGCAAGUAUACUGCCCUAGAAGUGCUGCACGUUGUGGGGCCC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- lung squamous cell carcinoma
- squamous cell lung cancer
- head and neck squamous cell cancer
- non-small cell lung carcinoma
- non-small cell lung cancer
- gastric cancer
- cervical squamous cell carcinoma
- large cell lung carcinoma
- epithelial cancer
- small cell lung cancer
role in cell
- expression in
- number
- accumulation in
- activation in
- quantity
- apoptosis
- response by
- production in
- proliferation
- differentiation