The following mature miRNA have the same seed sequence: GGCAGUG
| ID | hsa-miR-34a-5p |
| Accession | MIMAT0000255 |
| Sequence | 22 - UGGCAGUGUCUUAGCUGGUUGU - 43 |
| Seed Sequence | GGCAGUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- head and neck squamous cell cancer
- neoplasia
- acute myeloid leukemia
- multiple sclerosis
- small cell lung cancer
- squamous cell lung cancer
- nonalcoholic fatty liver disease
- lung squamous cell carcinoma
- prostate cancer
- schizophrenia
role in cell
- invasion
- migration
- expression in
- phosphorylation in
- proliferation
- replication in
- cell cycle progression
- cell death
- apoptosis
- downregulation in