Mirna Stemloop Summary
| id | hsa-mir-155 |
| Accession | MI0000681 |
| Comments | Human mir-155 is predicted based on homology to a cloned miR from mouse (MIR:MI0000177) [1], and later experimentally validated in human HL-60 leukemia cells [2]. Like the mouse miRNA, human mir-155 resides in the non-coding BIC transcript (EMBL:AF402776), located on chromosome 21 [3]. The mature form differs from that in mouse at a single position. Eis et al. confirm that miR-155 is processed from the BIC transcript in human, and demonstrate elevated expression of miR-155 in lymphoma samples [4]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [5]. |
| Description | Homo sapiens miR-155 stem-loop |
| Gene Family | MIPF0000157;mir-155 |
| Genome Context | chr21: 25573980-25574044 [+] |
| miRna Matures Links | |
| Sequence | CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG |