The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-155 |
| Accession | MI0000681 |
| Genome Context | chr21: 25573980-25574044 [+] |
| Associated Mature miRNA | |
| Sequence | CUGUUAAUGCUAAUCGUGAUAGGGGUUUUUGCCUCCAACUGACUCCUACAUAUUAGCAUUAACAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- gastric cancer
- colorectal cancer
- epithelial cancer
- cancer
- precursor B-cell acute lymphoblastic leukemia
- obesity
- weight gain
- colon cancer
- lymphoma
- neoplasia
role in cell
- apoptosis
- expression in
- quantity
- activation in
- transcription in
- phosphorylation in
- growth
- cell viability
- permeability
- damage