The following mature miRNA have the same seed sequence: AAAGUGC
| ID | hsa-miR-17-5p |
| Accession | MIMAT0000070 |
| Sequence | 14 - CAAAGUGCUUACAGUGCAGGUAG - 36 |
| Seed Sequence | AAAGUGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- Alzheimer disease
- invasive ductal breast cancer
- schizophrenia
- neoplasia
- epithelial cancer
- psoriasis
- non-insulin-dependent diabetes mellitus
- pancreatic ductal adenocarcinoma
- pancreatic epithelial cancer
- ductal pancreatic cancer
role in cell
- activation in
- production in
- apoptosis
- differentiation
- proliferation
- survival
- downregulation in
- cell viability
- expression in
- migration