The following mature miRNA have the same seed sequence: ACAGUAC
| ID | hsa-miR-101-3p |
| Accession | MIMAT0000099 |
| Sequence | 47 - UACAGUACUGUGAUAACUGAA - 67 |
| Seed Sequence | ACAGUAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- prostate cancer
- Alzheimer disease
- experimental autoimmune encephalomyelitis
- HER2 negative hormone receptor negative breast cancer
- ALK positive anaplastic large cell lymphoma
- T-cell non-Hodgkin disease
- mature T-cell neoplasia
- ALK fusion positive cancer
- head and neck squamous cell cancer
role in cell
- expression in
- proliferation
- apoptosis
- phosphorylation in
- activation in
- growth
- downregulation in
- molecular cleavage in
- radiosensitivity
- suppression in