The following mature miRNA have the same seed sequence: AGGUAGU
| ID | hsa-miR-196a-5p |
| Accession | MIMAT0000226 |
| Sequence | 7 - UAGGUAGUUUCAUGUUGUUGGG - 28 |
| Seed Sequence | AGGUAGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- liver cancer
- cancer
- metastatic colorectal cancer
- endometriosis
- pancreatic ductal adenocarcinoma
- pancreatic epithelial cancer
- ductal pancreatic cancer
- survival
- metastatic melanoma
- metastatic melanoma cancer
role in cell
- expression in
- migration
- invasion by
- cell proliferation
- differentiation
- migratory capacity
- development
- granulopoiesis
- detachment
- chemosensitivity