The following mature miRNA have the same seed sequence: GUCAGUU
| ID | hsa-miR-223-3p |
| Accession | MIMAT0000280 |
| Sequence | 68 - UGUCAGUUUGUCAAAUACCCCA - 89 |
| Seed Sequence | GUCAGUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- colorectal cancer
- psoriasis
- lung cancer
- non-small cell lung cancer
- breast cancer
- non-insulin-dependent diabetes mellitus
- gastric cancer
- endometriosis
- interstitial pneumonia
- small cell lung cancer
role in cell
- expression in
- phosphorylation in
- apoptosis
- production in
- proliferation
- activation in
- differentiation
- cell viability
- number
- invasion by