The following mature miRNA have the same seed sequence: GGAGUGU
| ID | hsa-miR-122-5p |
| Accession | MIMAT0000421 |
| Sequence | 15 - UGGAGUGUGACAAUGGUGUUUG - 36 |
| Seed Sequence | GGAGUGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- epithelial cancer
- diabetes mellitus
- hepatocellular carcinoma
- liver cancer
- survival
- tumorigenesis
- organismal death
- hyperglycemia
- nonalcoholic fatty liver disease
- metastasis
role in cell
- expression in
- growth
- cell viability
- apoptosis
- migration
- proliferation
- transactivation in
- production in
- invasion
- replication in