The following mature miRNA have the same seed sequence: AAGGCAC
| ID | hsa-miR-124-3p |
| Accession | MIMAT0000422 |
| Sequence | 53 - UAAGGCACGCGGUGAAUGCCAA - 74 |
| Seed Sequence | AAGGCAC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- non-small cell lung cancer
- non-insulin-dependent diabetes mellitus
- neoplasia
- Alzheimer disease
- prostate cancer
- experimental autoimmune encephalomyelitis
- colorectal cancer
- organismal death
- behavioral variant frontotemporal dementia
- postmenopausal osteoporosis
role in cell
- expression in
- phosphorylation in
- growth
- apoptosis
- production in
- proliferation
- differentiation
- cellular infiltration by
- activation
- damage