The following mature miRNA have the same seed sequence: CUCCCAA
| ID | hsa-miR-150-5p |
| Accession | MIMAT0000451 |
| Sequence | 16 - UCUCCCAACCCUUGUACCAGUG - 37 |
| Seed Sequence | CUCCCAA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- adenoma formation
- epithelial cancer
- hepatocellular carcinoma
- liver cancer
- cardiac fibrosis
- colorectal cancer
- survival
- small cell lung cancer
- adult T-cell leukemia/lymphoma
- mature T-cell neoplasia
role in cell
- proliferation
- expression in
- survival
- invasion by
- apoptosis
- cell viability
- activation
- transition
- differentiation
- permeability