Mirna Stemloop Summary
| id | hsa-mir-204 |
| Accession | MI0000284 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the ends mapped by cloning. Landgraf et al. confirm expression in human [2]. |
| Description | Homo sapiens miR-204 stem-loop |
| Gene Family | MIPF0000042;mir-204 |
| Genome Context | chr9: 70809975-70810084 [-] |
| miRna Matures Links | |
| Sequence | GGCUACAGUCUUUCUUCAUGUGACUCGUGGACUUCCCUUUGUCAUCCUAUGCCUGAGAAUAUAUGAAGGAGGCUGGGAAGGCAAAGGGACGUUCAAUUGUCAUCACUGGC |