The following mature miRNA have the same seed sequence: UCCCUUU
| ID | hsa-miR-204-5p |
| Accession | MIMAT0000265 |
| Sequence | 33 - UUCCCUUUGUCAUCCUAUGCCU - 54 |
| Seed Sequence | UCCCUUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- hypopharyngeal squamous cell carcinoma
- nonconvulsive seizure
- Alzheimer disease
- renal clear cell adenocarcinoma
- renal clear cell cancer
- nonobstructive azoospermia
- bladder cancer
- medulloblastoma SHH subtype
- brain cancer
- epilepsy
role in cell
- expression in
- apoptosis
- proliferation
- differentiation
- migration
- activation in
- antiapoptosis
- invasion by
- sphere formation by
- maturation