The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-122 |
| Accession | MI0000442 |
| Genome Context | chr18: 58451074-58451158 [+] |
| Associated Mature miRNA | |
| Sequence | CCUUAGCAGAGCUGUGGAGUGUGACAAUGGUGUUUGUGUCUAAACUAUCAAACGCCAUUAUCACACUAAAUAGCUACUGCUAGGC |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- metastatic colorectal cancer
- gallbladder cancer
- hepatic steatosis
- epithelial cancer
- epithelial neoplasia
- cancer
- breast cancer
- glioma formation
- abdominal cancer
role in cell
- invasion by
- expression in
- proliferation
- migration
- apoptosis
- morphology
- number
- downregulation in
- differentiation
- abnormal morphology