Mirna Stemloop Summary
| id | hsa-mir-145 |
| Accession | MI0000461 |
| Comments | This miRNA sequence was predicted based on homology to a verified miRNA from mouse [1]. Michael et al. subsequently verified expression of miR-145 in human, and demonstrated significantly reduced levels of the miRNA in precancerous and neoplastic colorectal tissue [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [4]. |
| Description | Homo sapiens miR-145 stem-loop |
| Gene Family | MIPF0000079;mir-145 |
| Genome Context | chr5: 149430646-149430733 [+] |
| miRna Matures Links | |
| Sequence | CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU |