The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-145 |
| Accession | MI0000461 |
| Genome Context | chr5: 149430646-149430733 [+] |
| Associated Mature miRNA | |
| Sequence | CACCUUGUCCUCACGGUCCAGUUUUCCCAGGAAUCCCUUAGAUGCUAAGAUGGGGAUUCCUGGAAAUACUGUUCUUGAGGUCAUGGUU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- Alzheimer disease
- seizures
- neoplasia
- breast cancer
- prostate cancer
- liver cancer
- cancer
- epithelial cancer
- epithelial neoplasia
- organismal death
role in cell
- formation in
- migration
- proliferation
- expression in
- apoptosis
- quantity
- growth
- formation
- differentiation
- activation