The following mature miRNA have the same seed sequence: GGCUCAG
| ID | hsa-miR-24-3p |
| Accession | MIMAT0000080 |
| Sequence | 44 - UGGCUCAGUUCAGCAGGAACAG - 65 |
| Seed Sequence | GGCUCAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- diabetes mellitus
- kainic acid-induced epileptic seizure
- non-insulin-dependent diabetes mellitus
- breast cancer
- colorectal neoplasm
- colorectal neoplasia
- chronic epilepsy
- sporadic amyotrophic lateral sclerosis
- HER2 negative hormone receptor negative breast cancer
- osteoarthritis
role in cell
- growth
- expression in
- apoptosis
- survival
- proliferation
- loss
- differentiation
- growth in
- production in
- derepression in