The following mature miRNA have the same seed sequence: AAUACUG
| ID | hsa-miR-200b-3p |
| Accession | MIMAT0000318 |
| Sequence | 57 - UAAUACUGCCUGGUAAUGAUGA - 78 |
| Seed Sequence | AAUACUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- lung cancer
- prostate cancer
- breast cancer
- epithelial cancer
- tumorigenesis
- liver cancer
- metastatic melanoma
- primary open-angle glaucoma
- Alzheimer disease
- diabetes mellitus
role in cell
- apoptosis
- formation
- expression in
- cell death
- proliferation
- quantity
- growth
- cell viability
- phosphorylation in
- differentiation