The following mature miRNA have the same seed sequence: CAAAGCA
| ID | hsa-miR-330-3p |
| Accession | MIMAT0000751 |
| Sequence | 57 - GCAAAGCACACGGCCUGCAGAGA - 79 |
| Seed Sequence | CAAAGCA |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- ulcerative colitis
- deep vein thrombosis
- breast cancer
- postmenopausal osteoporosis
- organismal death
- breast carcinoma
role in cell
- expression in
- phosphorylation in
- migration
- invasion by
- tamoxifen resistance