The following mature miRNA have the same seed sequence: CACAGUG
| ID | hsa-miR-128-3p |
| Accession | MIMAT0000424 |
| Sequence | 50 - UCACAGUGAACCGGUCUCUUU - 70 |
| Seed Sequence | CACAGUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- organismal death
- gastric cancer
- nonobstructive azoospermia
- cervical squamous cell carcinoma
- squamous cell cervical cancer
- gout
- LMNA-related congenital muscular dystrophy
- colorectal cancer
- glioma cancer
role in cell
- expression in
- growth