The following mature miRNA have the same seed sequence: AUAAAGU
| ID | hsa-miR-142-5p |
| Accession | MIMAT0000433 |
| Sequence | 16 - CAUAAAGUAGAAAGCACUACU - 36 |
| Seed Sequence | AUAAAGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- non-insulin-dependent diabetes mellitus
- lung squamous cell carcinoma
- squamous cell lung cancer
- lung adenocarcinoma
- lung adenocarcinoma formation
- breast carcinoma
- breast cancer
- gastric cancer
- pancreatic neoplasia
role in cell
- proliferation
- apoptosis
- phosphorylation in
- expression in
- quantity
- growth
- migration
- cell viability
- invasion by