The following mature miRNA have the same seed sequence: GUAGUGU
| ID | hsa-miR-142-3p |
| Accession | MIMAT0000434 |
| Sequence | 52 - UGUAGUGUUUCCUACUUUAUGGA - 74 |
| Seed Sequence | GUAGUGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- breast cancer
- neoplasia
- metastasis
- psoriasis
- idiopathic pulmonary fibrosis
- T-cell non-Hodgkin disease
- mature T-cell neoplasia
- osteoporosis
- endometriosis
- systemic lupus erythematosus
role in cell
- expression in
- phagocytosis by
- cell death
- proliferation
- quantity
- phagocytosis