The following mature miRNA have the same seed sequence: AACACUG
| ID | hsa-miR-141-3p |
| Accession | MIMAT0000432 |
| Sequence | 59 - UAACACUGUCUGGUAAAGAUGG - 80 |
| Seed Sequence | AACACUG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- metastasis
- epithelial cancer
- prostate cancer
- lung cancer
- diabetes mellitus
- colorectal cancer
- T-cell prolymphocytic leukemia
- endometriosis
- Cushing syndrome
- corticotrophic adenoma
role in cell
- phosphorylation in
- proliferation
- expression in
- invasion by
- migration
- apoptosis
- invasion
- differentiation
- growth
- epithelial-mesenchymal transition