The following mature miRNA have the same seed sequence: UCACAGU
| ID | hsa-miR-27a-3p |
| Accession | MIMAT0000084 |
| Sequence | 51 - UUCACAGUGGCUAAGUUCCGC - 71 |
| Seed Sequence | UCACAGU |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- neoplasia
- lung cancer
- non-insulin-dependent diabetes mellitus
- sporadic amyotrophic lateral sclerosis
- lymphatic metastasis
- gastric cancer
- hepatocellular carcinoma
- liver cancer
- epithelial cancer
- pancreatic epithelial cancer
role in cell
- cell viability
- migration
- expression in
- apoptosis
- growth
- proliferation
- differentiation
- invasion by
- colony formation
- permeability