The following stemloop miRNA have the same biologically relevant information.
| ID | hsa-mir-223 |
| Accession | MI0000300 |
| Genome Context | chrX: 66018870-66018979 [+] |
| Associated Mature miRNA | |
| Sequence | CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGCGGCACAUGCUUACCAG |
| Synonyms |
Top Findings
The most significant associations for this gene, including commonly observed domains, pathway involvement, and functional highlights based on current data.
disease
- gastric cancer
- neoplasia
- liver cancer
- epithelial cancer
- endometriosis
- breast cancer
- colorectal cancer
- experimental autoimmune encephalomyelitis
- limb-girdle muscular dystrophy type 2A
- enteritis
role in cell
- phosphorylation in
- expression in
- apoptosis
- activation in
- proliferation
- cell viability
- function
- growth
- production in
- quantity