Mirna Stemloop Summary
| id | hsa-mir-223 |
| Accession | MI0000300 |
| Comments | This human miRNA was predicted by computational methods using conservation with mouse and Fugu rubripes sequences [1]. Expression of the excised miR has been validated in zebrafish, and the 5' end mapped by PCR. Landgraf et al. confirm expression in human [2]. The mature sequence shown here represents the most commonly cloned form from large-scale cloning studies [2]. |
| Description | Homo sapiens miR-223 stem-loop |
| Gene Family | MIPF0000067;mir-223 |
| Genome Context | chrX: 66018870-66018979 [+] |
| miRna Matures Links | |
| Sequence | CCUGGCCUCCUGCAGUGCCACGCUCCGUGUAUUUGACAAGCUGAGUUGGACACUCCAUGUGGUAGAGUGUCAGUUUGUCAAAUACCCCAAGUGCGGCACAUGCUUACCAG |